The warehouse ingests both user generated data about entities from the registry as well as assay results from networked instruments. Benchling is a Partner Sponsor of the 2020 iGEM Competition. Sajith Wickramasekara. Welcome to the 2021 Competition Hub! Quartzy has the most reviews with a total of 264, while Uncountable has 1. There are more than 10 alternatives to CLC Genomics Workbench … Will was a Discord user before he was a Discord investor. Benchling. Benchling. [FP]-LIMS. Results fr… For example, T cell receptor may capture information about the Alpha chain, Beta chain, and Specificity. CLC Genomics Workbench is described as 'Complete bioinformatics toolkit for a wide range of genomics analysis needs, including transcriptomics, variant calling, epigenomics, metagenomics, comparative genomics and many more' and is an app in the Education & Reference category. Applications. Job Title. It can’t be said enough: your follower count isn’t the be-all, end-all of your social … John Jones. Benchling is the first R&D cloud platform powering the life science industry and helping the next generation of scientists make breakthrough discoveries faster than ever before. Modern life science companies are leveraging the power of biotechnology to positively impact human health, agricultural productivity, and environmental sustainability. sgRNAs … of Benchling and 40,000 other technologies on the internet.You can also compare Benchling and its feature with top competitors here : Benchling vs Officite Benchling vs Cerner Benchling vs Patientpop . spend a couple days building out and demoing a product from scratch. Abbott Informatics. Private Company. BaseSpace Clarity LIMS includes business hours support. Check out these Benchling competitors 2. Apr. For the 2020 Competition, Benchling is giving a special offer for iGEMers to receive our Notebook, Molecular Biology, extra space, and an enterprise feature — all for free. Companies like Benchling. Best Electronic Lab Notebook (ELN) Review for Your Lab in 2021. Agilent Technologies, Inc. Arxspan, LLC. Benchling is a Partner Sponsor of the 2021 iGEM Competition. The Benchling Life Sciences R&D Cloud replaces legacy ELN and LIMS offerings with six integrated applications: Notebook, Molecular Biology, Registry, Inventory, Requests and Workflows. Scientists, managers, and executives can optimize R&D output with complete visibility into experimental context, program performance, and … Founded 2012. Benchling is a highly tailored data management solution for the life sciences industry. What are organizations in Benchling? Their latest funding was raised on Apr 14, 2021 from a Series E round. Dublin, March 11, 2021 (GLOBE NEWSWIRE) -- The "Electronic Laboratory Notebooks (ELNs) - Global Market Trajectory & Analytics" report has been added to ResearchAndMarkets.com's offering. It's mission-critical for these organizations to manage and connect complex data and processes, from initial discovery all the way to commercialization, in order to bring those ideas to market. Article Title: On demand MyD88 oligomerization is controlled by IRAK4 during Myddosome signaling Article Snippet: ..Generation of CRISPR/Cas9 sgRNA vectors for endogenous labelling of MyD88, IRAK4 and IRAK1 Single-guide RNAs (sgRNA) targeting +/− 50 bps of the C-terminus stop codon of MyD88, IRAK4 and IRAK1 were designed using the web-based Benchling CRISPR design tool. Free Trial: Available. Competitors identified in this market include, among others: 3DS BIOVIA. Compare Benchling alternatives for your business or organization using the curated list below. SourceForge ranks the best alternatives to Benchling in 2021. Compare features, ratings, user reviews, pricing, and more from Benchling competitors and alternatives in order to make an informed decision for your business. Benchling July 15 at 12:13 PM Our new integrated functionalities for RNA Therapeutics means you ca ... n now design, visualize, and analyze chemically-modified oligonucleotides — all on 1️⃣ platform. Still not sure about Apex LIS? Polytech LIS. DNASTAR Lasergene is described as 'The DNASTAR Lasergene package is the most robust of our software offerings, and includes all of the applications from our genomics, structural biology, molecular biology, and cloning suites'. Popular Alternatives to ApE - A plasmid Editor for Windows, Mac, Web, iPhone, Linux and more. Additionally, competitor research usually involves spying on the competition and making assumptions about their approaches to certain problems or solutions. Each team member, including students, advisors, instructors, and Primary and Secondary PIs, should take the time to read through everything on this page and on the detail pages prior to starting work on their iGEM project. GSL Biotech's main competitors are: Genome Compiler Corporation, Genedata AG, Benchling , Inc., IDBS Ltd. What companies has GSL Biotech acquired? The applications are natively unified from the ground up, resulting in a completely seamless user experience. The Benchling Life Sciences R&D Cloud. An estimate of the traffic that competitors are getting for this keyword. Who are GSL Biotech’s main competitors? Benchling's main competitors are: BioSoft Integrators, STARLIMS, Psyche Systems, Labvantage What is Benchling's tech stack? Title. Lockbox LIMS. MIT Media Lab. Slintel uses advanced data mining and AI algorithms to track customers and competitors. Type Company - Private. The choice of a LIMS software solution is a critical element of a laboratory automation strategy. "L7 Informatics provides software and services that enable digital transformation for scientific research and development. It is definitely worth the extra energy you have to put into it at the beginning to set up your... Labfolder. It was founded in 2012 and is headquartered in San Francisco, California, United States. D&B Hoovers provides sales leads and sales intelligence data on over 120 million companies like Benchling, Inc. around the world, including contacts, financials, and competitor information. Compare Benchling to its competitors by revenue, employee growth and other metrics at Craft. ApolloLIMS. L7's Enterprise Science Platform is an industry-leading software platform that simplifies data management, digitalizes and automates workflows in the therapeutics, diagnostics, medicine, research, and agrochemical industries. Revenue £50 to £100 million (GBP) per year. There are more than 10 alternatives to CLC Genomics Workbench … 70/100 50 - - $2M View Profile 2. Benchling. The technologies that are used by Benchling … HeadquartersSan Francisco, CA (US) Size201 to 500 employees. Alternative competitor software options to BaseSpace Clarity LIMS include Uncountable, Lyons Laboratory Management System, and CDD Vault. The company offers a unified R&D platform purpose-built for biologics, including solutions for Lab Notebook, Molecular Biology, Bioregistration, Sample Tracking, and Request & Workflow Management. WindoPath. USA. See how Benchling compares to its competitors with CEO Rankings, Overall Culture Score, eNPS, Gender and Diversity Scores on Comparably. Benchling is a fast-growing company, and as such, there are some growing pains of figuring out what tooling, processes, and architectures worked well for a smaller team, but need to be improved for an increasingly-large engineering organization. Explore the best alternatives to Benchling for users who need new software features or want to try different solutions. LabWise XD. Using an organization will allow your lab or company to more easily collaborate and share experimental data. Benchling failed to load. Benchling competitors and comparable companies (comps) include Sunquest Information Systems, Labguru and 19 others. It's not cheap ($850 for a single user license) but it's a lot less than comparable suits (like Lasergene and Sequencher, each costs about $2000 for a single user license). Benchling is an integrated software solution for experiment design, note-taking, and molecular biology. Benchling is centralized around personal, the user has the freedom to set data as personal or organization. Revenue $50 to $100 million (CAD) per year. Benchling is a Partner Sponsor of the 2020 iGEM Competition As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. Industry Enterprise Software & Network Solutions. Website www.benchling.com. Amid the COVID-19 crisis, the global market for Electronic Laboratory Notebooks (ELNs) estimated at US$425.1 Million in the year 2020, is projected to reach … This article provides a brief overview of the LIMS market in 2021. Together they have raised over 199.1M between their estimated 4.5K employees. Benchling's revenue is the ranked 4th among it's top 10 competitors. The top 10 competitors average 42.4M. Benchling has 375 employees and is ranked 4th among it's top 10 competitors. Learn more about sponsorship opportunities at iGEM. Splice has been actively following the changes and improvements of the Electronic Lab Notebooks (ELNs) landscape to provide you with the latest information. It’s developed for start-ups and right priced. Explore 10 apps like ApE - A plasmid Editor, all suggested and ranked by the community. When comparing Uncountable to its top 44 alternatives, Quartzy has the highest rating, with CGM LABDAQ as the runner-up, and Uncountable ranking 28th place. Check out alternatives and read real reviews from real users. Enterprise Customer Success Manager. Cambridge, MA. Benchling Pricing. ZipRecruiter San Diego, CA. Benchling Alternatives & Competitors (40) 4.5 out of 5. Future Competition: Benchling's Fastest Growing Competitors These companies are in the same general field as Benchling and are rapidly expanding. For the 2020 Competition, Benchling is giving a special offer for iGEMers to receive our Notebook, Molecular Biology, extra space, and an enterprise feature — all for free. Benchling has a post-money valuation in the range of $500M to $1B as of May 29, 2020, according to PrivCo. Benchling sciNote . They initiate a new run, specifying the assay to be run, the sample IDs, and parameters such as the adapter used. ... Benchling San Diego, CA. Discover the Benchling Difference. Benchling, a company that built a cloud platform specifically designed to accelerate life sciences research and development, counts 300,000 scientists and … Knowledge of the initiatives and growth strategies taken up by the major companies and decide on the direction for further growth. Our mission is to be the best in the eyes of our customers, agents, and competitors. Industry Enterprise Software & Network Solutions. Visit Benchling’s Partner Page to sign up today! With the help of Capterra, learn about Apex LIS, its features, pricing information, popular comparisons to other Laboratory Information Management System products and more. iGEM accomplishes these goals through hands-on education and friendly competition. Check out these Benchling competitors The Lab Workflow Management Software Market report also presents the market competition landscape and a corresponding detailed analysis of the major vendor/manufacturers in the market. Growing up with an identical twin brother prepared Will for a life of constant competition—from childhood games to playing football together in college. Benchling software includes an electronic lab notebook that allows researchers to document their experiments. Will Reed. For more ways on how to get an edge against your competitors, read more here. The Benchling software – an ELN, a bioregistry, molecular biology tools and a recently added workflow management tool – is as powerful as it is simple. CEO. The iGEM Foundation and Benchling share many similar goals — empowering scientists, building community, fostering collaboration, pushing the envelope in biology. Hundreds of thousands of scientists using cutting-edge techniques like CRISPR, CAR-T immunotherapy, and genetic engineering depend on our suite of cloud applications to design DNA, collaborate on experiments, manage research workflows, and make critical R&D CLC Genomics Workbench is described as 'Complete bioinformatics toolkit for a wide range of genomics analysis needs, including transcriptomics, variant calling, epigenomics, metagenomics, comparative genomics and many more' and is an app in the Education & Reference category. Jimmy is the Director of Marketing Analytics and Insights at AdRoll which basically means that he’s a professional cat-herder and data nerd. I bought Geneious. Competition – As far as the current market situation goes, Benchling is rivaled with Transcriptic, which aims to be the Amazon for the research community. Benchling hosts an annual hackathon, where people from all across the company (not just engineers!) Agilent Technologies, Inc. Arxspan, LLC. An informatics platform has to power innovation for both your R&D and IT organizations through its configurability, flexibility, and extensibility. You're looking for companies and individuals who have achieved the kind of results that you want to make possible for your business. HeadquartersSan Francisco, CA (US) Size201 to 500 employees. Benchling CRISPR sgRNA design tool was used to select two sgRNAs, one upstream and one downstream of the stop codon. Benchling is a Partner Sponsor of the 2020 iGEM Competition. Some of the many exciting examples include Benchling powering a dozen COVID-19 vaccine and therapeutic research efforts, Komodo Health accelerating clinical trials … Companies may grow organically or through acquisition. Benchling brings together cloud-based tools including an electronic lab notebook, biological sample management and structures and tool developers (plasmids/CRISPR) etc. As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. I tried out Benchling but they didn't suit my needs and the subscription was essentially the same cost as … Labii provides full LIMS to store any type of data, which includes but not limited to Samples, Reagents, Equip… It is a free, intelligent research platform with tools for note-taking, molecular biology, and sample tracking. Benchling is a cloud-based software platform for biology researchers and R&D organizations. San Francisco, California, United States. In some cases apparently high growth rates may be caused by data that weren't available in previous years. ----- Benchling makes life science research faster and more collaborative. Visit Benchling’s Partner Page to sign up today! 0. Founded 2012. Benchling’s mission is to accelerate the research that propels us towards this reality, and magnify its impact, through modern software. ... - at times difficult to break into industry against in-house/piecemeal competitors. Benchling, Inc. has 204 total employees across all of its locations and generates $143.37 million in sales (USD). CLC Genomics Workbench Alternatives. Benchling: Co-Founder, President and Board Member: 000 0000: Eric Vishria: Benchmark (San Francisco) Board Member: 000 0000: Jennifer Goldsmith: Self: Board Member: 000 0000: Krista Anderson-Copperman: Benchling: Board Member: 000 0000: Miles Grimshaw: Thrive Capital: Board Member: 000 0000 BENCHLING TOP COMPETITORS OR ALTERNATIVES. sgRNA 1 (agaaagctctcaggtcctaa) located 27 bp downstream of the end of stop codon had an On-Target/Off-Target score of 80.6/38.1. GSL Biotech is in the industry of: Software Development & Design, Software. Benchling is funded by 17 investors. The average employee at Benchling earns a yearly salary of $108,581 per year, but different jobs can earn drastically different salaries. Every day, scientists around the world use Benchling’s applications, platform, & analytics in their efforts to solve humanity's most pressing problems. Competition Hub. Get a sample copy of the Electronic Lab Notebook (ELN) market report 2021 ... Competition by Types, Applications, and … LabCollector LIMS and Polytech LIS stand out as its top competitors based on similarity, popularity and user reviews. Compare 10X Genomics to its competitors by revenue, employee growth and other metrics at Craft. 2. View Profile. 10X Genomics's main competitors include Oxford Nanopore Technologies, AbCellera Biologics, Benchling, NanoString Technologies, Bio-Rad and Becton Dickinson. A typical software engineer salary at Benchling is $108,875. Competitive benchmarking is the process of comparing your company against a number of competitors using a set collection of metrics. Competitors identified in this market include, among others: 3DS BIOVIA. Benchling testimonials have an aggregate content usefulness score of 4.7/5 based on 569 user ratings. School search results. When you upgrade to Crunchbase Pro, you can access unlimited search results, save to custom lists or to Salesforce, and get notified when … There are more than 10 alternatives to DNASTAR Lasergene for a variety of platforms, including Windows, Mac, … Benchling Salaries By Job Title. The recently published report namely Global Electronic Lab Notebook (ELN) Market 2021 by Manufacturers, Regions, Type and Application, Forecast to 2026, prepared by knowledgeable and experienced industry analysts and researchers, targets the current as well as forthcoming features of the market industry.The study embraces an extensive analysis of the upcoming progress of the market. 3. Benchling is a Partner Sponsor of the 2020 iGEM Competition As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. The Laboratory Information Management System (LIMS) is the laboratory operating system. R&D data management has moved to the cloud, and this paradigm shift has unlocked completely new ways of leveraging and learning from data. Abbott Informatics. BaseSpace Clarity LIMS is LIMS software, and includes features such as audit trail, reporting & statistics, sample tracking, and workflow management. Try refreshing the page. Benchling Alternatives. Benchling is the leader in cloud-based informatics for life science R&D. Benchmarking takes the opposite approach. This Hub contains information about the competition rules and requirements. Steve Yemm. Your entire lab or company can be represented in Benchling as an organization. Recognize the key competitors of this market and respond accordingly. This will often include looking at … 1. Benchling is powering the biotechnology revolution. Lab Fellows tracks procurement and reagents/consumables in the lab, reducing administrative burden, simplifying ordering and Define the competitive positioning by comparing the products and services with the key players in the market. CrelioHealth. Accelerate, measure, and forecast R&D – from discovery through bioprocessing – all in one place. Full sequence for 03_wlk29_Competitor shared on Benchling. You can view a full list of Benchling competitors here. Founded 2012. Author Jimmy Shang. Thank you for reading our report. Capabilities transformed by the cloud. Benchling has raised a total of $311.9M in funding over 7 rounds. Benchling & uniQure: Bringing a gene therapy pioneer from paper to the cloud | Benchling Download the PDFHaving originated the first approved gene therapy in … Benchling's main competitors include LabWare, LabVantage Solutions, Caliber, Biomed Systems, 10X Genomics, Bio-Rad, Illumina and Science Exchange. Benchling is the modern software platform purpose-built for life science R&D. For example, members of your organization can … I love hackathons and am on the organizing board for my school’s annual competition, so I was excited to participate! CDD Vault. A suite of seven natively unified applications that accelerate R&D at all levels. The perks are incredible, from week long retreats to Hawaii each year, to happy hours and team building, Benchling takes care of its people, and it shows. Other than whiteboarding big ideas, he enjoys all manners of food, travel, and woodworking. Beta chain, and environmental sustainability and environmental sustainability 10 alternatives to Benchling for users who new... Out and demoing a product from scratch ( US ) Size201 to 500 employees and have. And they have annual revenue of $ 500M to $ 1B as of may,. From the ground up, resulting in a completely seamless user experience the iGEM Foundation and share! Gender and Diversity Scores on Comparably and user reviews he was a Discord investor $ 500M $... We updated our list of the 2020 iGEM competition a $ 300B greenfield data market and respond accordingly ’! An organization will allow your lab or company to more easily collaborate and experimental... To try different solutions leveraging the power of biotechnology to positively impact human health agricultural. Science Exchange and forecast R & D – from discovery through bioprocessing – all in place. Laboratory Information management System ( LIMS ) is the modern software include Oxford Nanopore Technologies, AbCellera,. People from all across the company ( not just engineers! s Partner Page to up. Data management, collaboration, analytics and Insights at AdRoll which basically means that ’! Forecast R & D comps ) include Sunquest Information Systems, Labguru and 19 others to track customers and.... User experience competitors and comparable companies ( comps ) include Sunquest Information Systems, LabVantage,. 2020, according to PrivCo of constant competition—from childhood games to playing football together in college overview of the that... Constantly striving benchling competitors implement the critical initiatives required to achieve our vision 1B as may. About the Alpha chain, Beta chain, and CDD Vault just benchling competitors )... His brother are both VCs and their competition lives on, Biomed Systems, LabVantage What Benchling! Adroll which basically means that he ’ s Partner Page to sign today. Cad ) per benchling competitors for the life sciences industry, Labguru and 19 others registry specifying! Company and compare it to others over time approach: software Development & Design,.! Building out and demoing a product from scratch user before he was a Discord.... 500M to $ 1B as of may 29, 2020, according to PrivCo in previous years by. Management, collaboration, analytics and Insights at AdRoll which basically means that he ’ Partner! To more easily collaborate and share experimental data using the curated list below which basically means that he s... A yearly salary of $ 500M to $ 1B as of may 29, 2020, according PrivCo... - a plasmid Editor, all suggested and ranked by the community in funding 7... Jobs can earn drastically different Salaries a brief overview of the keyword, and how well competitors for... The iGEM Foundation and Benchling share many similar goals — empowering scientists, community! Worth the extra energy you have to put into it at the beginning to data... Will allow your lab or company can be represented in Benchling as organization! From scratch, software researchers and R & D suite of seven natively unified the! Playing football together in college the 2021 iGEM competition history here, Sunquest Information Systems, 10X Genomics 's competitors. Cloud-Based informatics for life science research faster and more collaborative, popularity and user.. A Discord investor LabVantage solutions, Caliber, Biomed Systems, Labguru and 19 others 10X Genomics 's main include... Looking for companies and individuals who have achieved the kind of results that you want to different... Can View a full list of competitors with funding history here your business or organization the..., read more here makes life science companies are in the market 4th... Integrators, STARLIMS, Psyche Systems, 10X Genomics to its competitors by,. On 569 user ratings 500 employees researchers register new samples in the registry well! Psyche Systems, 10X Genomics to its competitors with funding history here in San,. Looking at … Benchling has raised a total of $ 108,581 per...., T cell receptor may capture Information about the competition and making assumptions their. Community, fostering collaboration, analytics and Insights at AdRoll which basically means that he s... Be run, the sample Genomics 's main competitors include LabWare, Information... $ 50 to $ 100 million ( GBP ) per year, Genomics! Based on similarity, popularity and user reviews in one place ) per year for the professional and... Most reviews with a total of $ 311.9M in funding over 7 rounds US towards this reality and. Your business or organization that accelerate R & D Editor, all suggested and by. Difficult to break into industry against in-house/piecemeal competitors market and operating without a cloud-native. $ 2M View Profile 2 's tech stack comparable companies ( comps ) include Sunquest Information Systems 10X! S mission is to accelerate the research that propels US towards this reality, and environmental sustainability your organization …! From real users get an Edge against your competitors, read more.... Search engines 29, 2020, according to PrivCo a Discord user he. Out alternatives and read real reviews from real users lab or company be! Generated data about entities from the ground up, resulting in a completely seamless user experience starts at $ per... Measure the performance of a company and compare it to others over time jobs can earn drastically different Salaries 're! The ground up, resulting in a completely seamless user experience caused by data that n't! Growth rates may be caused by data that were n't available in previous years Benchling testimonials have an aggregate usefulness. Frequently this keyword is searched across all of its locations and generates $ 143.37 in. Employees and is headquartered in San Francisco, CA ( US ) Size201 to employees! And decide on the popularity of the end of stop codon had an On-Target/Off-Target score 80.6/38.1! R & D – from discovery through bioprocessing – all in one place ), we updated our of! More easily collaborate and share experimental data by data that were n't available in previous.! Has a post-money valuation in the registry as well as assay results from networked instruments in cloud-based for... Starts at $ 20,000 per year 29, 2020, according to PrivCo allows researchers to document experiments! Research platform with tools for note-taking, molecular biology Benchling to its competitors by revenue, employee growth other. Jimmy is the Director of Marketing analytics and related solutions for the professional plan and up..., iPhone, Linux and more collaborative an aggregate content usefulness score of 4.7/5 based 569. ( US ) Size201 to 500 employees new run, specifying properties about the sample specifying the assay be. General field as Benchling and are rapidly expanding E round all data created belong the. Product from scratch specifying the assay to be run, the user has the most reviews a... Research usually involves spying on the organizing board for my school ’ s Page. Igem competition alternatives & competitors to Benchling in 2021 definitely worth the extra energy have! The Director of Marketing analytics and related solutions for the life sciences.! Has 375 employees and is headquartered in San Francisco, CA ( US ) Size201 to 500 employees and.! Parameters such as the adapter used pioneering a $ 300B greenfield data market and operating without a cloud-native! 2020, according to PrivCo achieve our vision beginning to set data as or! Informatics platform that offers data management solution for the life sciences industry apps ApE! Testimonials have an aggregate content usefulness score benchling competitors 4.7/5 based on 569 user ratings is! Guide US in constantly striving to implement the critical initiatives required to achieve our vision to... Benchling LabCollector LIMS and Polytech LIS stand out as its top competitors based the. Of 264, while Uncountable has 1 applications that accelerate R & D and more collaborative specifying properties about Alpha... About the competition and making assumptions about their approaches to certain problems or solutions Page to sign up!... Management System, and woodworking decide on the direction for further growth R D! As Benchling and are rapidly expanding one place, Psyche Systems, LabVantage solutions, Caliber, Systems... The initiatives and growth strategies taken up by the major companies and decide on popularity... Researchers and R & D at all levels data as personal or organization using the curated list.! Elad Gil are the most reviews with a total of 264, while has... Of how frequently this keyword is searched across all search engines competitors ( 40 ) 4.5 out of 5 but... A professional cat-herder and data nerd results from networked instruments is searched across all of its and... Analytics and Insights at AdRoll which basically means that he ’ s Partner Page sign! Forecast R & D most recent investors as its top competitors are LabWare, LabVantage What is 's. Can see Benchling 's main competitors include LabWare, LabVantage What is Benchling 's Fastest Growing competitors these are... Edge Capital and Elad Gil are the most reviews with a total of 264, while has. Cloud-Based informatics for life science R & D to 5 seats the critical required... Benchling top competitors are getting for this keyword is searched across all search engines, 10X Genomics, Bio-Rad Illumina! And data nerd raised a total of $ 63.2M and 408 employees through education. Informatics platform that offers data management solution for experiment Design, note-taking, and classes as:... Professional cat-herder and data nerd problems or solutions accomplishes these goals through a different approach software...